Catalog Products
Catalog Products
Oligo Products
Random Hexamer
A Random Hexamer N6 is a six-base oligonuclotide sequence that is synthesised completely randomly. The six
N-wobbles (N= A, G, C, or T) provide a variety of possible sequences (46 possibilities) that can bind to many random positions of a single-stranded DNA or RNA sequence.
The Random Hexamer serves as a universal primer that can be extended by DNA polymerase in the DNA synthesis or by reverse transcriptase during the cDNA synthesis. In this way, a cDNA pool with different cDNA lengths can be generated.
| Art.no. | Product | Pack size |
| SP10001 | Random Hexamer 6N (NNNNNN) | 1 OD |
| 5 OD | ||
| 10 OD |
The Random Hexamer can be ordered directly by e-mail. Please send us an e-mail to order@biomers.net stating the article number.
Oligo dT20
As an alternative to the Random Hexamer, an Oligo dT20 can also initiate the first strand cDNA synthesis by reverse transcriptase. Oligo dT20 consists of 20 deoxythymidines and can bind as a primer to the complementary poly A tail of eukaryotic mRNA. The reverse transcription reaction allows the synthesis of cDNA from the total RNA.
| Art.no. | Product | Pack size |
| SP10002 | Oligo dT20 | 1 OD |
| 5 OD | ||
| 10 OD |
You can easily order the Oligo dT20 by e-mail. Please send us an email to order@biomers.net stating the article number and size of the package.
RNase Substrate
For the simple detection of RNases, a short fluorescence-labelled probe can be used as a substrate:
Available with biomers.net are the substrates 6-Fam-dArUdAdA-BHQ1 and 6-Fam-dArUdAdA-BMN-Q530.
In addition to three DNA bases, the probes also have a RNA base rU. In the absence of the RNase enzyme, the fluorescence of the 6-Fam is quenched. After digestion of the substrate at the labile bond at the base rU, the fluorophore and quencher are separated and the increase in fluorescence of the flourescent dye 6-Fam can be detected at 520 nm.
| Art.no. | Product | Pack size |
| SP10003 | RNase substrate (-BHQ1) | 10 nmol |
| SP10010 | RNase substrate (-BMN-Q530) | 10 nmol |
Further information about the RNase substrate can be found here.
The order will be sent directly by e-mail to order@biomers.net.
Smart-seq2 oligonucleotides (TSO, Oligo-dT30VN, ISPCR)
For the Smart-seq2 assay, showing improved sensitivity and accuracy for single-cell transcriptome analysis comprising the generation of full-length cDNA and sequencing libraries, certain oligonucleotides are necessary.
| Art.no. | Product | Sequence | Pack size |
| SP10004 | TSO Oligo | AAGCAGTGGTATCAACGCAGAGTACAT667 6: rG; 7: +G (Locked Nuc Acid) |
1 OD |
| SP10005 | Oligo-dT30VN | AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN | 1 OD |
| SP10006 | ISPCR oligo | AAGCAGTGGTATCAACGCAGAGT | 1 OD |
Further information about Smart-seq2 assay and a detailed protocol can be found here.
The order will be sent directly by e-mail to order@biomers.net.