Page id: 254

Katalogprodukte

 

Katalogprodukte

Oligo Produkte

 

Primer/Probe-Mixe zur Detektion von COVID-19-Varianten zur Verwendung mit dem QIAprep& Viral RNA UM Kit

Random Hexamer

Bei einem Random Hexamer N6 handelt es sich um eine Oligonucleotidsequenz von sechs Basen, die vollständig zufällig synthetisiert wird. Die sechs aufeinanderfolgenden N-Wobbles (N= A, G, C, oder T) ergeben eine Vielzahl von möglichen Sequenzen (46 Möglichkeiten), die an vielen zufälligen Abschnitten einer einzelsträngigen DNA- oder
RNA-Sequenz binden können. Das Random Hexamer dient dabei als universeller Primer, der durch die
DNA-Polymerase bei der DNA-Synthese oder mithilfe der reversen Transkriptase während der cDNA-Synthese verlängert werden kann. Auf diese Weise kann ein cDNA-Pool mit verschiedenen cDNA-Längen erzeugt werden.

Art.nr. Produkt Packungsgröße
SP10001 Random Hexamer 6N (NNNNNN) 1 OD
5 OD
10 OD


Das Random Hexamer können Sie direkt per E-Mail bestellen. Senden Sie uns bitte hierzu unter Angabe der Artikelnummer eine E-Mail an order@biomers.net.

Oligo dT20

Alternativ zum Random Hexamer kann auch ein Oligo dT20 die Synthese eines cDNA-Erststrangs mittels reverser Transkriptase initiieren. Oligo dT20 besteht aus 20 Desoxythymidinen und kann als Primer komplementär an den poly A Schwanz von eukaryotischer mRNA binden. Die reverse Transkriptionsreaktion ermöglicht damit die Synthese von cDNA aus der Gesamt-RNA.

Art.nr. Produkt Packungsgröße
SP10002 Oligo dT20 1 OD
5 OD
10 OD


Das Oligo dT20 können Sie bequem per E-Mail bestellen. Bitte senden Sie uns unter Angabe der Artikelnummer und Packungsgröße eine E-Mail an order@biomers.net

Universal Reporter

Die folgenden Universal Reporter mit den entsprechenden Fluoreszenzfarbstoffen stehen standardmäßig zur Verfügung (unterstrichen ist jeweils die Mediatorbinderegion).
Die Anbindung des internen Farbstoffes erfolgt entweder über einen dC- (7) oder dT-Baustein (8).

Art.nr. Produkt int. Farbstoff Sequenz Packungsgröße
UR10001 Universal Reporter URA Fam ATTGCGGGAGATGAGACCCGCAA8TGTTGGTCGTAGAGCCCAGAACGA 1 nmol
UR10002 Universal Reporter URB Hex GACCGGCTAAGACGCGCCGGT7TGTTGCACCTGGGACATCGACTAT 1 nmol
UR10003 Universal Reporter URC Rox GACCGCACTAGTAGATGCGGT7TGTCGTGGACCCTGTATCGAGCA 1 nmol
UR10004 Universal Reporter URD Cyanine 5 GACCGGCCAAGACGCGCCGGT7TGTTCACTGACCGAACTGGAGCA 1 nmol
UR10005 Universal Reporter URE Cyanine 5.5 GACGCGTAGTACAGAACGCGT7TGTTCAGTGAGCCTACCTGCCTTC 1 nmol


Weitere Informationen zur Anwendung der Mediator Probe PCR finden Sie hier.
Die Bestellung der Universal Reporter erfolgt per E-Mail an order@biomers.net

RNase Substrat

Zum einfachen Nachweis von RNasen kann eine kurze fluoreszenzmarkierte Sonde als Substrat genutzt werden:
6-Fam-dArUdAdA-BHQ1
Neben drei DNA-Basen besitzt die Sonde noch die RNA-Base rU. In Abwesenheit des Enzyms RNase wird die Fluoreszenz des 6-Fam durch den in unmittelbarer Nähe befindlichen Quencher gelöscht. Nach RNase-Spaltung des Substrats am rU sind Fluorophor und Quencher getrennt und der Anstieg der Fluoreszenz des 6-Fam kann bei
520 nm detektiert werden. 

Art.nr. Produkt Packungsgröße
SP10003 RNase Substrat 10 nmol


Weitere Informationen zum RNase Substrat finden Sie hier
Die Bestellung erfolgt direkt per E-Mail an order@biomers.net. 

Smart-seq2 Oligonucleotide (TSO, dT30VN, ISPCR)

Beim Smart-seq2, ein Verfahren zur Herstellung von Full-Length cDNA und Sequenzierbibliotheken, die eine verbesserte Sensitivität und Genauigkeit für Transkriptom-Analysen aus einzelnen Zellen aufweisen, kommen bestimmte Olignucleotide zum Einsatz. 

Art.nr. Produkt Sequenz Packungsgröße
SP10004 TSO Oligo AAGCAGTGGTATCAACGCAGAGTACAT667
6: rG; 7: +G (Locked Nuc Acid)
1 OD
SP10005 Oligo-dT30VN AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN 1 OD
SP10006 ISPCR oligo AAGCAGTGGTATCAACGCAGAGT 1 OD


Weitere Informationen zum Smart-seq2 Assay sowie ein detailliertes Protokoll finden Sie hier
Die Bestellung erfolgt direkt per E-Mail an order@biomers.net. 

FLAP-Sonden zur smiFISH mRNA-Detektion

smiFISH benötigt neben den Target-spezifischen Primärsonden eine fluoreszenzmarkierte Sekundärsonde (FLAP).
Hierbei stehen drei verschiedene FLAP-Sonden (FLAP X, FLAP Y oder FLAP Z) zur Auswahl. Jede Sekundärsonde wird jeweils am 5´- und 3´-Ende mit einem Fluoreszenzfarbstoff markiert. 

Art.nr. Produkt Sequenz Packungsgröße
SM10001 FLAP X (Fam) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10002 FLAP X (Cyanine 3) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10003 FLAP X (Cyanine 5) CAC TGA GTC CAG CTC GAA ACT TAG GAG G 1 OD
SM10004 FLAP Y (Fam) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10005 FLAP Y (Cyanine 3) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10006 FLAP Y (Cyanine 5) AAT GCA TGT CGA CGA GGT CCG AGT GTA A 1 OD
SM10007 FLAP Z (Fam) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD
SM10008 FLAP Z (Cyanine 3) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD
SM10009 FLAP Z (Cyanine 5) CTT ATA GGG CAT GGA TGC TAG AAG CTG G 1 OD


Weitere mögliche Fluoreszenzfarbstoffe finden Sie hier. Weitere Informationen zur Anwendung smiFISH finden
Sie hier. Die Bestellung erfolgt direkt per E-Mail an order@biomers.net.

 

Chemikalien für die Oligonucleotid-Synthese

 

Phosphoramidite

Art.nr. Produkt Packungsgröße
PA10001 5´-Hydrazid Modifier Phosphoramidit 100 µmol
0,25 g


Die Bestellung erfolgt per E-Mail an order@biomers.net. Geben Sie hierbei einfach die Artikelnummer des Produktes und die gewünschte Packungsgröße an. 

Azide für Click Chemie

Art.nr. Produkt Packungsgröße
FA10001 Nile Blue Azid 1 mg
5 mg
  DNP-PEG3 Azid 1 mg
5 mg
  Trolox-PEG3 Azid 1 mg
5 mg
  Tocopherol-PEG3 Azid 1 mg
5 mg
  Folsäure-PEG3 Azid 1 mg
5 mg


Die Bestellung erfolgt per E-Mail an order@biomers.net. Geben Sie hierbei einfach die Artikelnummer des Produktes und die gewünschte Packungsgröße an.