Page id: 105

Antisense Oligos


Antisense-Oligonucleotide sind kurze, synthetische Ketten aus einzelsträngigen Nucleinsäuren. über komplementäre Basenpaarung binden Antisense-Oligonucleotide, ähnlich der siRNA, an eine dazu passende Basensequenz. Über die Bindung der Antisense-Oligos an die komplementäre mRNA wird die Translation und somit auch die spezifische Biosynthese der Zielproteine verhindert. Der vom Oligonucleotid gebundene RNA-Strang wird daraufhin von der RNase H erkannt und enzymatisch gespalten, wodurch das Antisense-Oligonucleotid frei wird und erneut Nucleinsäuren mit komplementärer Basensequenz binden kann. Bezüglich der siRNA, bindet ein Strang der siRNA die komplementäre mRNA, die daraufhin vom RISC (RNA-induced silencing complex), einem Komplex aus mehreren Proteinen, zerstört wird. Auch in diesem Fall werden die Translation und die Synthese der Proteine verhindert. 

Über Träger-Moleküle, meist Lipide, kann die Aufnahme und die darauffolgende Verteilung in den Zellen verbessert werden. In der Zelle können die Oligos auf zwei verschiedenen Ebenen therapeutisch wirken: zum einen durch die gezielte Inhibierung der Translation, wodurch auch die Synthese der Zielproteine verhindert wird und zum anderen durch eine nicht-antisense-abhängige Wirkung. Über die Zusammensetzung der Basenabfolge können CpG-Dinucleotid-reiche Oligos eine unspezifische Immunantwort auslösen. In diesem Fall werden Oligonucleotide synthetisiert, die bakterieller, CpG-reicher DNA ähneln. Zusätzliche Modifikationen, wie das Einfügen von Phosphothioaten, können diese Immunantworten nochmals verstärken. 



Literatur:
- An antisense oligonucleotide primer. Hogrefe RI; Antisense and Nucleic Acid Drug Development (1999), 9(4): 351-357. 

- Prospects for nucleic acid-based therapeutics against hepatitis C virus.  Lee CH, Kim JH, Lee S-W. World J Gastroenterol. (2013), 19(47): 8949–8962.

- CpG-A and CpG-B oligonucleotides differentially enhance human peptide–specific primary and memory CD8 T-cell responses in vitro. Rothenfusser S, Hornung V, Ayyoub M, Britsch S, Towarowski A, Krug A, Sarris A, Lubenow N, Speiser D, Endres S, Hartmann G; Blood (2004), Vol.103, Number 6.

- CpG-A Oligonucleotides Induce a Monocyte-Derived Dendritic Cell-Like Phenotype That Preferentially Activates CD8 T Cells. Krug A, Rothenfusser S, Selinger S, Bock C, Kerkmann M, Battiany J, Sarris A, Giese T, Speiser D, Endres S, Hartmann G;. J Immunol (2003), 170:3468-3477.
 

Phosphothioate

Phosphothioat-Oligonucleotide (Phosphorothioat, PTO)

 

Die Phosphothioat-Modifikation des DNA-Rückgrates ist eine der ersten und auch heute noch vielfach verwendeten Modifikation für Antisense-Oligonucleotide (Antisense Oligos der 1. Generation). Dabei wird im Phosphat-Rückgrat eines der beiden nicht an der Internucleotidbrücke beteiligten Sauerstoffatome durch ein Schwefelatom ersetzt (siehe Abb.). Das zentrale Phosphoratom ist dadurch aufgrund der vier unterschiedlichen Substituenten ein Chiralitätszentrum was Diastereomerenbildung zur Folge hat.
In einem Oligonucleotid können alle Phosphate durch Phosphothioat ersetzt werden (Full-PTO) oder auch nur einzelne (Teil-PTO). Um die gewünschte Stabilität gegen Abbau zu erzielen, scheint es oft ausreichend jeweils an den Enden des Oligos zwei bis vier PTOs einzubauen.

Phosphothioat Oligonucleotide (PTO)


Bestellinformation:

Phosphothioate werden im Bestellsystem von biomers.net durch Sternchen (*) dargestellt. Sollen alle oder einzelne Phosphodiester durch Phosphothioate ersetzt werden, muss an der jeweiligen Stelle ein * in die Sequenz eingefügt werden. 

Beispiele:

  • Eine normale Sequenz ohne Phosphothioate:
    agcgtgacgtggacgtgagtga
  • Die identische Sequenz, jedoch als "Full-PTO-Oligo" (alle internucleotidischen Phosphodiester gegen PTO ausgetauscht):
    a*g*c*g*t*g*a*c*g*t*g*g*a*c*g*t*g*a*g*t*g*a
  • Die Sequenz mit einzelnen PTOs ("Teil-PTO"), in diesem Fall jeweils drei PTOs an den Enden:
    a*g*c*gtgacgtggacgtgag*t*g*a
  • Die Sequenz mit einer PTO-Brücke ("Teil-PTO") am 3'-Ende:
    agcgtgacgtggacgtgagtg*a

Soll ein PTO-Oligo an einem Ende noch modifiziert werden, beispielsweise mit einem Fluoreszenzfarbstoff, ist es oft sinnvoll auch die Phosphatbrücke zwischen Oligo und Modifikation zu "stabilisieren", also als PTO zu synthetisieren. 
Bei einer 5'-Modifikation wird in diesem Fall noch ein * an das 5'-Ende des Oligos angefügt (bei einer 3'-Modifikation entsprechend an das 3'-Ende) und die gewünschte Modifikation im Menü ausgewählt:

  • *a*g*c*g*t*g*a*c*g*t*g*g*a*c*g*t*g*a*g*t*g*a,  5'-Modifikation: Biotin : PTO zwischen Biotin und Oligo
  • a*g*c*g*t*g*a*c*g*t*g*g*a*c*g*t*g*a*g*t*g*a,  5'-Modifikation: Biotin : Phosphodiester zwischen Biotin und Oligo

2'-modifizierte RNA

2'-modifizierte RNA


Dabei handelt es sich um Modifikationen an der 2´-Position der Ribose. biomers.net bietet Ihnen hierbei eine Auswahl an verschiedenen Modifikationen an:

  • 2´-OH
  • 2´-O-Methyl
  • 2´-O-Propargyl
  • 2´-O-Propylamin
  • 2´-Amino
  • 2´-Fluoro


Wenn am 2´-Kohlenstoff des Zuckers ein Sauerstoff verknüpft ist, handelt es sich definitionsgemäß um eine Ribose. Dies schließt aber nicht aus, dass diese Ribose die Base Thymin (anstelle von Uracil) tragen kann. 

2´-modifizierte RNA

Antisense-Oligonucleotide, die eine 2´-Ribose-Modifikation (2´-O-Methyl) aufweisen, zeigen zumeist in vitro eine erhöhte Stabilität gegen enzymatische Degradation. Hieraus kann auch eine leichte Verbesserung der Verteilung der Oligos in der Zelle, sowie eine verbesserte Pharmakokinetik der Antisense-Oligos abgeleitet werden1. Des Weiteren konnte beobachtet werden, dass 2´-modifizierte Oligonucleotide (2´-O-Methyl, 2´-O-Propyl, 2´-O-Fluoro) mit größerer Affinität an komplementäre RNA hybridisieren2

Fragen Sie unseren Kundensupport nach Verfügbarkeit und Lieferzeit.
Tel +49 731 70 396 0 | info@biomers.net 



Literatur:
1. Pharmacokinetic Properties of 2´-O-(2-Methoxyethyl)-Modified Oligonucleotide Analogs in Rats. Geary RS, Watanabe TA, Truong L, Freier S, Lesnik EA, Sioufi NB, Samor H, Manoharan M, Levin AA; The Journal of Pharmacology and experimental Therapeutics (2001), Vol. 296, No. 3; JPET 296:890–897.

2. Evaluation of 2´-Modified Oligonucleotides Containing 2’-Deoxy Gaps as Antisense Inhibitors of Gene Expression. Monia BP, Lesnik EA, Gonzalez C, Lima WF, McGee D, Guinosso CJ, Kawasaki AM, Cook PD, Freier SM; The Journal of Biological Chemistry (1993), Inc. Val. 268, No. 19, pp. 14514-14522.

Chimären

Chimäre Oligonucleotide


Chimäre Oligonucleotide können aus verschiedenen Arten von Bausteinen hergestellt werden. Im Gegensatz zu natürlich vorkommenden Molekülen können synthetisch hergestellte Oligos gleichzeitig aus DNA und RNA bestehen. Ebenso ist es möglich, dass diese Oligos aus rechts- und linksdrehenden Bausteinen gemischt werden (siehe L-DNA). 
Des Weiteren sind Mischungen mit reversen Bausteinen möglich, wodurch Moleküle generiert werden können, die an beiden Enden mit 3´ oder 5´ aufhören. 

Gerne stehen wir Ihnen für weitere Auskünfte zur Verfügung. 
Kontaktieren Sie uns. Wir helfen Ihnen gerne weiter.



Literatur:
- An Antisense Oligonucleotide Primer. Hogrefe RI; Antisense and Nucleic Acid Drug Development (1999), 9(4): 351-357. 

Modifikationen

Antisense Oligonucleotid-Modifikationen


Mangelhafte pharmakokinetische Eigenschaften und die wenig zielgerichtete Aufnahme der Oligonucleotidkonjugate in die Zelle stellen häufig die größten Schwierigkeiten einer erfolgreichen Entwicklung neuer Oligonucleotid-basierter Mittel dar. 
In Bezug auf Antisense-Oligonucleotide ist eine Vielzahl von Modifikationen verfügbar. Abgestimmt auf die jeweilige kundenspezifische Methode sind verschiedene interne bzw. endständige Veränderungen eines Oligonucleotids möglich. Mithilfe kleiner, an das Oligo angehängter Liganden kann die Aufnahme in die Zelle, sowie die zelluläre Verteilung dieser Oligonucleotidkonjugate beeinflusst werden, sodass sie für ein breites Spektrum therapeutischer Anwendungen eingesetzt werden können.
Kleine lipophile Moleküle, die an ein Oligonucleotid angehängt werden, können der stark negativ geladenen DNA oder RNA den Durchgang durch die Zellmembran und somit die Aufnahme in die Zelle erleichtern. So kann beispielsweise das Anhängen von Cholesterol an DNA- oder RNA-Moleküle die Stabilität und die Verteilung der Konjugate in der Zelle verbessern1 (Lipophile Modifikationen).

Tocopherol und Cholesterol

Modifikationen, die ebenfalls den Abbau der Oligonucleotide durch Nukleasen inhibieren können, stellen inverted-ends dar. An das 3´-terminale Nucleotid wird hierbei ein weiteres Nucleotid „verkehrt herum“ angehängt, sodass das Oligo an beiden Enden einen 5´-Terminus besitzt. Diese Art Schutzkappe am 3´-Terminus schützt das Oligonucleotid zum einen vor dem Abbau durch Exonukleasen, gleichzeitig wird die Elongation durch die Polymerase während der PCR gehemmt. 


 
inverted end


biomers.net bietet Ihnen in Bezug auf Antisense-Oligos eine umfangreiche Auswahl an Liganden und weiteren Modifikationen an. Unser erfahrenes Support Team hilft Ihnen gerne jederzeit bei allen Aspekten der Auswahl und des Einsatzes Ihrer spezifischen Oligonucleotide weiter. 



Literatur:
1. Oligonucleotide conjugates for therapeutic applications. Winkler J; Ther. Deliv. (2013), 4(7),791-809.