Page id: 254

On-Shelf Produkte

 

On-Shelf Produkte

Oligo Produkte

 

Random Hexamer

Bei einem Random Hexamer N6 handelt es sich um eine Oligonucleotidsequenz von sechs Basen, die vollständig zufällig synthetisiert wird. Die sechs aufeinanderfolgenden N-Wobbles (N= A, G, C, oder T) ergeben eine Vielzahl von möglichen Sequenzen (46 Möglichkeiten), die an vielen zufälligen Abschnitten einer einzelsträngigen DNA- oder
RNA-Sequenz binden können. Das Random Hexamer dient dabei als universeller Primer, der durch die
DNA-Polymerase bei der DNA-Synthese oder mithilfe der reversen Transkriptase während der cDNA-Synthese verlängert werden kann. Auf diese Weise kann ein cDNA-Pool mit verschiedenen cDNA-Längen erzeugt werden.

Art.nr. Produkt Packungsgröße
SP10000 Random Hexamer 6N (NNNNNN) 5 OD
 

Das Random Hexamer können Sie direkt per E-Mail bestellen. Senden Sie uns bitte hierzu unter Angabe der Artikelnummer eine E-Mail an order@biomers.net.

Oligo dT20

Alternativ zum Random Hexamer kann auch ein Oligo dT20 die Synthese eines cDNA-Erststrangs mittels reverser Transkriptase initiieren. Oligo dT20 besteht aus 20 Desoxythymidinen und kann als Primer komplementär an den poly A Schwanz von eukaryotischer mRNA binden. Die reverse Transkriptionsreaktion ermöglicht damit die Synthese von cDNA aus der Gesamt-RNA.

Art.nr. Produkt Packungsgröße
SP10001 Oligo dT20 1 OD
5 OD
10 OD
 

Das Oligo dT20 können Sie bequem per E-Mail bestellen. Bitte senden Sie uns unter Angabe der Artikelnummer und Packungsgröße eine E-Mail an order@biomers.net

Universal Reporter

Die folgenden Universal Reporter mit den entsprechenden Fluoreszenzfarbstoffen stehen standardmäßig zur Verfügung (unterstrichen ist jeweils die Mediatorbinderegion).
Die Anbindung des internen Farbstoffes erfolgt entweder über einen dC- (7) oder dT-Baustein (8).

Art.nr. Produkt int. Farbstoff Sequenz Packungsgröße
UR10003 Universal Reporter URA Fam ATTGCGGGAGATGAGACCCGCAA8TGTTGGTCGTAGAGCCCAGAACGA 1 OD
UR10004 Universal Reporter URB Hex GACCGGCTAAGACGCGCCGGT7TGTTGCACCTGGGACATCGACTAT 1 OD
UR10005 Universal Reporter URC Rox GACCGCACTAGTAGATGCGGT7TGTCGTGGACCCTGTATCGAGCA 1 OD
UR10006 Universal Reporter URD Cyanine 5 GACCGGCCAAGACGCGCCGGT7TGTTCACTGACCGAACTGGAGCA 1 OD
UR10007 Universal Reporter URE Cyanine 5.5 GACGCGTAGTACAGAACGCGT7TGTTCAGTGAGCCTACCTGCCTTC 1 OD
 

Weitere Informationen zur Anwendung der Mediator Probe PCR finden Sie hier.
Die Bestellung der Universal Reporter erfolgt per E-Mail an order@biomers.net

RNase Substrat

Zum einfachen Nachweis von RNasen kann eine kurze fluoreszenzmarkierte Sonde als Substrat genutzt werden:
6-Fam-dArUdAdA-BHQ1
Neben drei DNA-Basen besitzt die Sonde noch die RNA-Base rU. In Abwesenheit des Enzyms RNase wird die Fluoreszenz des 6-Fam durch den in unmittelbarer Nähe befindlichen Quencher gelöscht. Nach RNase-Spaltung des Substrats am rU sind Fluorophor und Quencher getrennt und der Anstieg der Fluoreszenz des 6-Fam kann bei
520 nm detektiert werden. 

Art.nr. Produkt Packungsgröße
SP10002 RNase Substrat 10 nmol
 

Weitere Informationen zum RNase Substrat finden Sie hier
Die Bestellung erfolgt direkt per E-Mail an order@biomers.net.

 

qPCR Mastermixe

 

qPCR Mastermixe

biomers.net bietet verschiedene qPCR Mastermixe an, die für die qPCR in Blocksystemen (z.B. Geräte von ABI, 
Applied Biosystems, etc.) optimiert wurden. Alle notwendigen Komponenten zur Durchführung einer quantitativen PCR sind in den Mastermixen in einer optimierten Menge enthalten.

Art.nr. Produkt Packungsgröße
MM10008 ProbeMasterMix (2X) High ROX Testsample
2 x 1,25 ml
10 x 1,25 ml
MM10009 ProbeMasterMix (2X) No ROX Testsample
2 x 1,25 ml
10 x 1,25 ml
MM10010 GreenMasterMix (2X) High ROX Testsample
2 x 1,25 ml
10 x 1,25 ml
MM10011 GreenMasterMix (2X) No ROX Testsample
2 x 1,25 ml
10 x 1,25 ml
 

Alle Mastermixe können Sie bequem per E-Mail bestellen. Bitte senden Sie uns unter Angabe der Artikelnummer und Packungsgröße eine E-Mail an order@biomers.net

 

Chemikalien für die Oligonucleotid-Synthese

 

Phosphoramidite

Art.nr. Produkt Packungsgröße
PA10012 5´-Hydrazid Modifier Phosphoramidit 100 µmol
0,25 g
 

Die Bestellung erfolgt per E-Mail an order@biomers.net. Geben Sie hierbei einfach die Artikelnummer des Produktes und die gewünschte Packungsgröße an.