Page id: 23

Häufig gestellte Fragen 
 

- Produkte und Service -
 

Ihre Forschung ist uns wichtig. 
Falls Sie Fragen haben oder sich Unklarheiten bei der Realisierung Ihres persönlichen Projekts ergeben, kontaktieren Sie bitte gerne jederzeit unser erfahrenes und kompetentes Kunden Support Team. Gerne helfen wir Ihnen weiter und beraten Sie bei der Auswahl Ihrer Oligonucleotide. Ihre Zufriedenheit und Ihr Vertrauen in uns und unsere Produkte sind uns äußerst wichtig!

Bestellung

 

Wie bestelle ich Oligos bei biomers.net?

Wir bieten Ihnen bei biomers.net verschiedene Möglichkeiten Ihre Oligonucleotide zu bestellen:

•    Online-Bestellsystem
Idealerweise bestellen Sie direkt über unser komfortables Online-Bestellsystem. Die Online-Bestellung gewährleistet die schnellste Bearbeitung Ihrer Aufträge. Durch die interaktive Funktion des Online-Formulars können viele Wünsche sofort eindeutig geklärt und umgesetzt werden, da hier nur gültige Modifikationen, Scales oder Reinigungsarten ausgewählt werden können. Auf diese Weise werden Rückfragen und Verzögerungen vermieden und Ihr Auftrag geht direkt und schnell in die Synthese. 

Einen weiteren Vorteil, den wir Ihnen bieten, ist unser Online-Archiv. Mithilfe dieses Archivs erhalten Sie einen Überblick über alte Bestellungen und haben die Möglichkeit einzelne, bereits bestellte Oligos erneut zu Ihrer Bestellliste hinzuzufügen. 
Wenn Sie zudem Ihre Bestellungen vor dem Versand speichern, haben Sie die Möglichkeit mehrere Oligobestellungen zusammenzufassen und uns diese zu einem späteren Zeitpunkt zuzusenden. Die Einrichtung eines gruppeninternen Accounts ermöglicht zudem die Koordinierung mehrerer Bestellungen. Indem Sie mehreren Personen den Zugriff auf ein gemeinsames biomers.net Konto gestatten, können einzelne Oligos der Bestellliste hinzugefügt werden und schließlich als eine Bestellung an uns gesendet werden. 
Online-Bestellformular  

•    Bulkbestellsystem
Mehrere Oligonucleotide des gleichen Scales und mit identischer Reinigungsart, die sich lediglich in Oligoname und Oligosequenz unterscheiden, können Sie am einfachsten über unser Bulkbestellsystem bestellen. 
Bulkbestellsystem 

•    Excel-Bestellformular
Eine weitere Möglichkeit der komfortablen Bestellung ist das Excel-Bestellformular. Insbesondere bei Oligonucleotiden, deren Modifikation, Scale oder Reinigung von der gültigen Kombination abweicht und dadurch im Online-Bestellformular nicht regulär wählbar ist, können Sie unser Excel-Bestellformular nutzen und Ihre gesonderten Wünsche in den entsprechenden Zeilen vermerken. Dieses schicken Sie uns bitte per E-Mail an order@biomers.net
Das Bestellformular können Sie hier herunterladen.

Bitte beachten Sie:
Da pdf-Dateien nicht automatisiert verarbeitet werden können, müssen wir hierfür wie für Faxbestellungen eine Bearbeitungsgebühr von 0,20 EUR je Base erheben.
Bei Fragen rund um die Bestellung Ihrer Oligos zögern Sie bitte nicht und kontaktieren uns jederzeit. Wir helfen Ihnen gerne weiter und beraten Sie auch bei der Auswahl unserer vielfältigen Modifikationen, sodass Sie ein optimales Ergebnis Ihrer Forschung erwarten können. 

•    Faxbestellformular
Unser Faxbestellformular bietet eine weitere Möglichkeit, Bestellungen bei uns aufzugeben. 
Das Formular finden Sie hier.

Bitte beachten Sie:
Bei Faxbestellungen erheben wir eine Bearbeitungsgebühr von 0,20 EUR je Base. Modifikationen und PTOs werden dabei als Basen gezählt. 
Faxbestellungen können nicht automatisch verarbeitet werden, sodass eine manuelle Eingabe Ihrer Bestellung erforderlich ist. Da uns bei diesem Vorgang Ihre Datensicherheit besonders wichtig ist und wir eine falsche Eingabe Ihrer Daten bei diesem Vorgang verhindern wollen, empfehlen wir Ihnen uns Ihre Bestellungen in elektronisch lesbarer Form (Excel, Onlineformular oder Mail) zuzusenden. 

Wie bestelle ich degenerierte Basen/Wobbles?

Eine Mischung aus mehreren, verschiedenen Basen (2-4) ist im Allgemeinen als Wobble-Base oder degenerierte Base bekannt. Der Nachfolgende, international gültige "Einbuchstaben-Code" gibt die möglichen Wobble-Kombinationen aus den vier Standardbasen wieder. Bitte verwenden Sie bei der Bestellung von Oligos mit degenerierten Basen diesen Code.

Code W S M K R Y B D H V N
Basenkombination AT CG AC GT AG CT CGT AGT ACT ACG ACGT
 

Zusätzlich zu den Standard-Wobble-Basenmischungen (jeweils die gleichen Anteile einer Base) können Sie auch Wobbles in einem spezifischen Basenverhältnis in Ihrer Bestellung angeben. Hierzu teilen Sie uns bitte Ihr gewünschtes Wobble-Basen-Verhältnis per E-Mail oder im Anmerkungsfeldfeld des Online-Bestellformulars mit. 
Weitere Informationen zu diesem Thema finden Sie hier.

Wie bestelle ich PTOs (Phosphothioate)?

Sie können Oligonucleotide als Teil-PTO oder Voll-PTO bestellen. Bei einem Teil-PTO werden nur einzelne Phosphate (internucleotidische Phosphodiester) durch Phosphothioate ersetzt, bei Full-PTO werden dagegen alle Phosphate ersetzt. Oft scheint der Einbau von zwei bis vier PTOs an den Enden des jeweiligen Oligos ausreichend zu sein, um das Oligo gegen einen Abbau zu stabilisieren. 
Im Bestellsystem geben Sie bitte Phosphothioate durch Sternchen (*) in Ihrer Sequenz an und fügen sie an der richtigen Position in die Sequenz ein. 

Beispiel:
•    Eine normale Sequenz ohne Phosphothioate: 
agcgtgacgtggacgtgagtga

•    Die identische Sequenz, jedoch als "Full-PTO-Oligo" (alle internucleotidischen Phosphodiester gegen PTOs ausgetauscht): 
a*g*c*g*t*g*a*c*g*t*g*g*a*c*g*t*g*a*g*t*g*a

•    Die Sequenz mit einzelnen PTOs ("Teil-PTO"), in diesem Fall mit jeweils drei PTOs an den Enden: 
a*g*c*gtgacgtggacgtgag*t*g*a

•    Die Sequenz mit einer PTO-Brücke ("Teil-PTO") am 3'-Ende: 
agcgtgacgtggacgtgagtg*a

Wenn Sie die Modifizierung eines Ihrer Oligo-Termini wünschen, beispielsweise mit einem Fluoreszenzfarbstoff, empfiehlt es sich auch die Phosphatbrücke zwischen Oligo und Modifikation zu "stabilisieren" und dieses als PTO zu synthetisieren. Fügen Sie bei der Bestellung an das entsprechende zu modifizierende Ende ein * ein und vermerken Sie die gewünschte Modifikation im Bestellmenü. 

Wie bestelle ich interne Sequenzmodifikationen (dI, dU)? 

Bitte geben Sie Desoxyinosin und Desoxyuridin wie auch Ribobasen und weitere modifizierte Basen (5-hm-dU, 5-Br-U, 5-Br-dU, 2´-F-dU, 2´-OMe-U, usw.) im Online-Bestellformular als interne Modifikation ein. 
Hierfür geben Sie bitte die gewünschte Position Ihrer internen Modifikation in der Sequenz durch die Zahlen (5-8) an, mit der das entsprechende Pulldown-Menüfenster im Bestellformular definiert ist. 
Bitte ordnen Sie interne Modifikationen, die A/G/C/T ersetzen, wie folgt zu: A - 5, G - 6, C - 7, T - 8.
Des Weiteren stellen Sie sicher, dass weder der Scale "XS" noch die Reinigungsart "Kartusche" ausgewählt ist.
Beide Einstellungen können bei Modifikationen nicht angewendet werden. 

                        

Wenn Sie weitere Informationen zu Desoxyinosin und Desoxyuridin benötigen, schauen Sie einfach auf unsere Website

Sind mehrere Modifikationen in einem Oligonucleotid möglich?

biomers.net bietet Ihnen ein umfangreiches Angebot an Modifikationen. Je nach Bedarf können Sie aus einer schier unendlichen Anzahl an Modifikationen das Passende auswählen, genau auf Ihre Forschung abgestimmt. 
In einem Oligonucleotid sind auch mehrere Modifikationen, terminal und intern, möglich. Bitte bedenken Sie jedoch, je komplexer die Modifikationen und die Anzahl gewählter Kombinationen in einem Oligonucleotid, desto aufwendiger und komplexer wird die Synthese. Auch die Syntheseausbaute nimmt bei mehrfach modifizierten Oligos tendenziell eher ab. 
Bei aufwendigen oder multiplen Modifikationen in einem Oligonucleotid setzen Sie sich bitte mit unserem Customer Support Team in Verbindung. 

Meine gewünschte Modifikation ist im Online-Bestellformular nicht verfügbar

Nicht alle bei uns verfügbaren Modifikationen können in jeder denkbaren Kombination an ein Oligo angehängt werden. In unserem Online-Bestellformular können Sie aus diesem Grund nur gültige Modifikationen, Scales, Reinigungsarten, etc. auswählen. Nicht zulässige oder eventuell nicht optimale Kombinationen werden in den entsprechenden Pull-Down Menüzeilen nicht angezeigt.  Falls Sie keinerlei Modifikationen zur Auswahl angezeigt bekommen, stellen Sie sicher, dass Sie weder den Scale "XS" noch die Reinigungsart "Kartusche" ausgewählt haben, da beide Einstellungen nicht mit Modifikationen kombiniert werden können. 

                         

Wenn Sie eine oder mehrere Modifikationen in Ihr Oligonucleotid einfügen möchten, diese jedoch nicht im Bestellformular auswählen können, kontaktieren Sie bitte unseren Kunden Support. Wir beraten Sie jederzeit gerne bei der passenden Auswahl Ihrer Modifikationen und zeigen Ihnen Alternativen auf, die eine Optimierung Ihrer Resultate gewährleisten. 
In vielen Fällen ist eine Zusendung Ihrer spezifischen Oligosequenz per E-Mail an unser Support Team sinnvoll. Unsere erfahrenen Synthesespezialisten und Chemiker erkennen anhand der Sequenz bereits evtl. Schwierigkeiten in der Synthese und können somit besser darauf eingehen. 

Wie ändere oder storniere ich meinen Auftrag? 

Sie haben Ihren Auftrag schon verschickt und benötigen noch ein weiteres Oligo, möchten Ihren gerade abgeschickten Auftrag doch noch ändern oder sogar stornieren? 

•    Hinzufügen 
Falls Sie nach Absenden Ihres Auftrags ein weiteres Oligo Ihrer Bestellung hinzufügen möchten, teilen Sie uns dies bitte umgehend, am besten per E-Mail oder Anruf, mit. Wir ergänzen Ihre Bestellung dann gerne um ein weiteres Oligonucleotid. 
Im Falle, dass sich Ihre Bestellung bereits in der Synthese befindet, werden wir nach der Synthese alle von Ihnen bestellten Oligos in einer Bestellung zusammenfassen und Ihnen im Gesamten zusenden, sodass keine zusätzlichen Lieferkosten für Sie entstehen.

•    Ändern
Bei Änderungen Ihrer Bestellung teilen Sie uns dies am besten schnellstmöglich per E-Mail oder Anruf mit. Jede Änderung eines Auftrages ist nur kurze Zeit nach Absenden Ihrer Bestellung noch möglich. Da wir Ihnen eine möglichst schnelle Lieferung Ihrer Oligonucleotide gewährleisten möchten, vergehen zwischen Auftragseingabe und Synthesestart nur wenige Minuten, manchmal sogar nur Sekunden. Änderungen, die innerhalb dieser Zeit bei uns eingehen, werden selbstverständlich von uns bearbeitet. 
Sobald Sie jedoch die Auftragsbestätigung (pdf) von uns erhalten haben, sind Ihre Synthesen gestartet und eine Änderung ist nicht mehr möglich. Später eingehende Benachrichtigungen von Ihnen können leider nicht mehr berücksichtigt werden. In diesem Fall können wir lediglich veranlassen, dass Ihre Aufträge (neu und alt) nach der Synthese zusammen verschickt werden.

•    Stornieren
Wenn Sie Ihre gerade verschickte Bestellung wieder stornieren möchten, ist dies ebenfalls nur bei zeitnaher Benachrichtigung Ihrerseits möglich. Wie bei Änderungen der Bestellung ist auch hier eine Stornierung nur möglich, wenn Sie die Auftragsbestätigung (pdf) noch nicht von uns erhalten haben. Sobald Sie diese vorliegen haben, hat die Synthese bereits begonnen und eine Stornierung ist nicht mehr möglich. 

Wo füge ich meinen biomers.net Rabattcode in der Bestellung ein?

Wenn Sie im Zuge einer Aktion oder eines Angebots von uns einen biomers.net Rabattcode erhalten haben, können Sie diesen in Ihrer nächsten Bestellung einfach mit angeben und der hinterlegte Rabatt wird von Ihrem Rechnungsbetrag abgezogen.

•    Online-Bestellformular
Nach Eingabe Ihres Oligonucleotids und aller relevanter Daten (Name, Sequenz, Modifikation, Scale, Reinigungsart, etc.) fügen Sie Ihr Oligo zur Bestellliste hinzu ("Oligo zur Bestellliste hinzufügen"). Den Rabattcode können Sie unter "Weitere auftragsbezogene Angaben" in der Zeile "Rabattcode" einfügen und einlösen. 

                         

 
•    Bulkbestellsystem
Nach Eingabe und Hochladen der Excel-Datei öffnet sich das Online-Bestellformular und der Rabattcode kann, nachdem die Oligos zu der Bestellliste hinzugefügt worden sind, unter "Weitere auftragsbezogene Angaben" in der Zeile "Rabattcode" eingegeben werden (siehe Abbildung oben). 

•    Excel-Bestellsystem
In Ihrem Excel-Bestellformular können Sie Ihren Rabattcode in der Zeile "Angebotscode" einfügen.

Angabe der Purchase Order (PO) Nummer (interne Bestellnummer) bei der Bestelleingabe

Wenn Ihre Verwaltung für die Abwicklung Ihrer Aufträge eine Bestellnummer vergibt, nehmen wir diese Nummer gern mit in die Begleitdokumente Ihres Auftrags mit auf. Dazu tragen Sie Ihre Purchase Order Nummer (interne Bestellnummer) in der Online-Bestellung unter "Weitere auftragsbezogene Angaben" in das Feld "Ihre interne Bestellnummer" ein.
Sollten Sie Ihre interne PO-Nummer bei der Bestelleingabe vergessen haben anzugeben, können Sie uns diese möglichst zeitnah, am einfachsten per E-Mail, mitteilen. Um eine einfache Zuordnung zu ermöglichen, beziehen Sie sich bitte auf Ihre Auftragsnummer (PAN) oder auf die Internet-Auftragsnummer (InetOrderNo). Solange Ihr Auftrag noch in Bearbeitung ist, fügen wir die Nummer gern hinzu. 

                         
 

VAT-Nummer

Bestellungen aus anderen Staaten innerhalb der EU erfordern die Angabe der spezifischen, individuellen VAT-Nummer (Steuernummer) in der Bestellung, andernfalls wird für den Auftrag die deutsche Mehrwertsteuer fällig (im Augenblick 19%). 

Auftragsbestätigung

Nach Absenden Ihrer Bestellung erhalten Sie von uns immer eine Bestätigung Ihrer Bestellung per Mail. Dieser können Sie nochmals alle Daten Ihrer bestellten Oligos, wie Name, Sequenz, Länge, Scale, etc. entnehmen. Die Sichtbarkeit der Sequenz Ihrer Oligos in der Bestätigungsmail können Sie während des Bestellvorgangs im Online-Bestellformular unter "Weitere auftragsbezogene Angaben" bearbeiten.

                           

Nach Bearbeitung Ihres Auftrags in unserem System wird Ihre Bestellung intern innerhalb weniger Minuten an unser Syntheselabor weitergeleitet und Sie erhalten abschließend eine automatisch generierte Auftragsbestätigung. Bitte kontrollieren Sie diese auf Richtigkeit Ihrer Liefer- und Rechnungsadresse und teilen Sie uns bitte eventuelle Unstimmigkeiten bzw. Fehler umgehend mit. 
Bitte beachten Sie, dass nach Erhalt Ihrer Auftragsbestätigung keine Änderungen Ihrer Oligo-Bestellung mehr möglich sind. 

Auftragsverfolgung

Das Live-Tracking ist nur möglich für Aufträge, die über das Online-Portal eingegangen sind. 
Hierzu melden Sie sich einfach mit Ihren Accountdaten auf unserer Website an und verfolgen Sie Ihren aktuellen Auftrag immer "live" mit dem Auftrags-Trackingcode. Diesen erhalten Sie per Mail nach Abschluss Ihrer Bestellung. Ihre Auftragsverfolgungsinformationen sind während unserer Geschäftszeiten normalerweise binnen 1 h nach Auftragseingang verfügbar, ansonsten am Morgen des darauffolgenden Werktags. So erhalten Sie immer aktuelle Informationen zu dem Stand der Produktion (z.B. "in Synthese", "in Qualitätskontrolle", etc.) jedes einzelnen Oligos. Nach dem Versand Ihres Auftrags wird dieser mit der DHL-Seite verlinkt. Dort können Sie den aktuellen Status der Lieferung Ihrer Oligos mit DHL einsehen. 
Auftragsverfolgung

                         
 

Auftragsarchiv

Lagern, sortieren oder exportieren Sie Ihre Daten in Ihrem Auftragsarchiv. 
Mithilfe unseres Auftragsarchivs haben Sie einen Überblick über alle Aufträge, die Sie bislang bei uns über das Online-Bestellformular bestellt und angelegt haben. Das Auftragsarchiv sammelt alle Daten Ihrer Online-Bestellungen für Sie ganz automatisch. Somit können auch evtl. verloren gegangene Datenblätter jederzeit wieder herunter geladen werden. 
Sie haben die Möglichkeit das Auftragsarchiv auch für andere Personen freizuschalten, sodass Sie gemeinsam Ihre Bestellungen und die damit verbundenen Datenblätter verwalten können. 
Auftragsarchiv 

Was bedeuten die Nummern bei meinem biomers.net Auftrag?

•    InetOrderNo 
Die von unserem Web-Bestellsystem vergebene Auftragsnummer.
Diese Nummer dient dazu, den Auftrag innerhalb des Web-Bestellsystems zu identifizieren und wird intern auch von der Auftragsverfolgung und dem Auftragsarchiv verwendet. Sie finden diese Nummer in der Informations-E-Mail, die unser Webbestellsystem beim Abschicken Ihres Auftrags erzeugt.  Auf den Dokumenten, die Ihren Auftrag in Papierform begleiten, werden folgende Nummern und Kennzeichnungen verwendet:

•    Produktionsnummer (1): Diese Nummer dient zur eindeutigen Identifizierung Ihres Oligonucleotids während des gesamten Produktionsprozesses. Diese Nummer ist in dem Barcode (Produktetikett und Barcode auf dem Qualitätszertifikat) kodiert.

•    PAN (=ProduktionsAuftragsNummer) / OrderCode (2): Diese achtstellige Nummer identifiziert Ihren Auftrag eindeutig innerhalb unseres Produktionssteuerungssystems und gegenüber unserer Buchhaltung. Diese Nummer ist damit die wichtigste Nummer zur Identifizierung Ihres Auftrags. Sie ist auf allen Datenblättern, Lieferscheinen und Rechnungen sowie den Produktetiketten enthalten, die Sie von biomers.net erhalten.
Über die PAN ist auch eine einfache Zuordnung der verschiedenen Dokumente (Belege) möglich, die den Auftrag begleiten. Die Auftragsbestätigung, der Lieferschein und die Rechnung zeigen zwar jeweils eine eigene "Belegnummer", die PAN ermöglicht aber die Zuordnung zu einem Auftrag. 

•    Oligonummer (3): Die laufende Nummer eines Oligonucleotids innerhalb eines Auftrags. Die Kombination aus PAN und Oligonummer, die sog. Oligo-ID, kennzeichnet ebenfalls ein Oligonucleotid eindeutig. Die Oligonummern in Ihrem Auftrag können durch Bearbeitungsvorgänge bei der Auftragsanlage ggf. Lücken aufweisen; aufgrund einer Neunummerierung aller Oligos einer Webbestellung beim Import in unser zentrales Produktionssystem kann es auch zu Abweichungen zwischen den laufenden Nummern der Oligonucleotide in Ihrer Webbestellung und denen im endgültigen Produktionsauftrag kommen. Letztere sind die relevanten Nummern.    

                                                      Nummernzuordnung des Oligonucleotisdatenblattes

Preise und Angebote

Die Preise können Sie unserer Preisliste entnehmen. Falls Sie Fragen bezüglich unserer Preise haben oder bei der Erstellung komplexerer Modifikationen den Preis in Erfahrung bringen möchten, können Sie uns natürlich jederzeit gerne kontaktieren. 
Preislisten 

Für individuelle Angebote zu einem unserer Oligos, wenden Sie sich bitte direkt an unser Customer Support Team. Ihre Anfrage wird bei Bedarf von unseren Synthesespezialisten geprüft. Auf diese Weise können wir auch seltene, nicht ganz "alltägliche" Modifikationen oder auch kundenspezifische Modifikationen nach Ihrem Wunsch realisieren. 
info@biomers.net

Frühaufsteherrabatt 

Auf alle Bestellungen, die zwischen 6:00 Uhr und 9:30 Uhr (MEZ/MESZ) bei uns eingehen, geben wir unabhängig von den bestellten Artikeln (ausgenommen Versandkosten) oder von bestehenden Rabatten (wenn dort nicht anders angegeben) 5% Frühaufsteher-Rabatt bei Bestellungen über das biomers.net Online-Bestellsystem oder per automatisch einlesbarer Excel-Dateien. 
Bitte beachten Sie, dass für Fax-Bestellungen und Sequenzübermittlung per pdf-Datei kein Frühaufsteher-Rabatt möglich ist, da diese nicht automatisch verarbeitet werden können. 

Synthese und Lagerung

 

Wie verläuft die Synthese meiner Oligos und wie lange dauert sie?

Nach Eingang Ihrer Bestellung bei uns erhalten Sie eine Auftragsbestätigung und Ihr Oligo geht umgehend in die Synthese. Mit dem Start der Synthesen werden die erforderlichen Chemikalien, Geräte und Materialien für die jeweilige Synthese festgelegt und "aktiviert", Änderungen sind nun nicht mehr möglich. Deshalb können nach Erhalt Ihrer Auftragsbestätigung (pdf) keine Änderungen oder Stornierungen in der Bestellung mehr vorgenommen werden.
Mithilfe der Phosphoamidit-Chemie (Caruthers MH et al., 1983) werden unsere Oligonucleotide synthetisiert. Technische Informationen über den genauen Syntheseablauf eines Oligonucleotids erfahren Sie hier
Unser Qualitätsmanagementsystem ist ISO9001 zertifiziert und gewährleistet auf diese Weise eine gleichbleibend hohe Qualität, auf die Sie in Ihrer Forschung vertrauen können.

Richtwerte der Synthesedauer: 

Art des Oligonucleotids  Synthesedauer
Unmodifizierte Oligonucleotide 1-2 Werktage
Modifizierte Oligonucleotide  3-5 Werktage
RNA-Oligonucleotide 10-14 Werktage
 

Bitte beachten Sie jedoch, dass es sich bei den angegebenen Synthesezeiten lediglich um Richtwerte handelt und nicht um exakte Termine der Fertigstellung. 

Die Qualität Ihrer Oligos ist uns wichtig!
Aus diesem Grund liefern wir ausschließlich Oligos, die die Qualitätskontrolle erfolgreich passiert haben. Wurden Abweichungen in der Qualität festgestellt, wird umgehend eine Neusynthese veranlasst. Selbstverständlich wird Ihnen diese nicht in Rechnung gestellt. 
Um unseren hohen Qualitätsansprüchen gerecht zu werden und damit auch Sie in Ihrer Forschung bestmögliche Ergebnisse mit unseren Produkten erzielen können, verschicken wir ausschließlich qualitativ hochwertige Oligonucleotide. Haben Sie daher bitte Verständnis, dass wir Ihnen kein konkretes Lieferdatum nennen können. 
Alle unsere Bestellungen werden so schnell wie möglich von uns bearbeitet und an Sie versandt. Bei Sendungen ins Ausland kann es jedoch zu Verzögerungen durch den Zoll kommen, die wir nicht beeinflussen können. 

Welche Reinigungsarten können gewählt werden? Wie wird eine gleichbleibende Qualität der Oligonucleotide gewährleistet?

biomers.net bietet Ihnen verschiedene Arten der Reinigung Ihres Oligos an:

•    Kartusche 
•    HPLC
•    PAGE

Hierbei muss beachtet werden, dass nicht alle Reinigungen bei jedem Oligo angewendet werden können. So werden Fluoreszenz-modifizierte Oligos standardmäßig HPLC gereinigt, bei unmodifizierten Oligos hingegen können je nach Länge und Verwendung unterschiedliche Reinigungen sinnvoll sein. 
Detailliertere Informationen über unsere Reinigungen von Oligonucleotiden erhalten Sie hier

Was bedeuten Synthese-Scale und Syntheseausbeute?

Der Synthese-Scale gibt die Menge an Ausgangsmaterial (CPG) an, die zu Beginn der Oligonucleotidsynthese (Festphasensynthese) eingesetzt wird. Der Synthese-Scale bezieht sich dabei NICHT auf die zu erwartende endgültige Ausbeute. 
Die finale Ausbeute eines Oligos ist abhängig von der Länge der Oligos, der Reinigung, möglicher Modifikationen und unter Umständen der Basenzusammensetzung. Üblicherweise wird die finale Ausbeute eines Oligos über die Messung seiner optischen Dichte (OD-Wert) ermittelt. Der OD-Wert wird experimentell gemessen und ermöglicht, hieraus die Stoffmenge (nmol) und die vorhandene Masse (µg) des Oligos zu berechnen.

biomers.net bietet Ihnen folgende Synthese-Scales und Syntheseausbeuten an:

Scale XS S M L XL
Stoffmenge 0,02 µmol  0,05 µmol 0,2 µmol 1,0 µmol 10,0 µmol
Ausbeute  2 OD  3-5 OD 10-20 OD  30-60 OD 200-400 OD
 
Scale XXL10MG XXL25MG XXL50MG XXL100MG XXL250MG XXL500MG
Stoffmenge, 20mer 1,5 µmol 3,5 µmol 7,5 µmol 15 µmol 38 µmol 77 µmol
Ausbeute  350 OD 850 OD 1700 OD 3400 OD 8500 OD 17000 OD
 

Bei allen Scales garantieren wir eine Mindestmenge, die wir Ihnen liefern. Im Fall der Scales XS-XL entspricht die gelieferte Mindestmenge den OD-Werten, bei den Scales der XXL-DNA der Menge in mg. So garantieren wir Ihnen beispielsweise im Scale XXL25MG eine Mindestmenge von 25mg. 
Da die synthetisierte Endmenge jedoch meist über diesem Mindestwert liegt, erhalten Sie von uns die gesamte synthetisierte Oligomenge.

Wieso erhalte ich bei mehreren Bestellungen des gleichen Oligos unterschiedliche Syntheseausbeuten (OD)?

Viele Faktoren können die endgültige Ausbeute eines Oligonucleotids beeinflussen. Wie bereits erwähnt, ist die Syntheseausbeute unter anderem von der Sequenzzusammensetzung und der Oligolänge abhängig. Der Hauptgrund, weshalb Sie bei einem Oligo identischer Sequenz und Länge unterschiedliche Ergebnisse erhalten, kann auf die Beladung des Trägermaterials oder auch Folgeprozeduren (z.B. Fällen der Oligos) zurückgeführt werden. Dieses Trägermaterial initiiert den Synthesezyklus der Oligonucleotide, wobei die minimalste "Beladungsmenge" hierbei wiederum vom bestellten Synthese-Scale abhängig ist. Abweichungen von der CPG-Menge und der CPG-Beladung können jedoch zu leicht abweichenden Syntheseausbeuten führen.

Wie ergeben sich die angegebenen OD-Werte auf dem Oligo-Datenblatt?    

In einem Spektralphotometer wird die Reinheit einer DNA durch das Verhältnis der Wellenlängen 260 nm zu 280 nm bestimmt. Der hieraus resultierende OD-Wert der Probe ist bei einer Wellenlänge von 260 nm per Definition der Extinktionswert der Probe. Dieser ergibt sich aus der Absorptionsmessung der Probe bei entsprechender Wellenlänge in 1 ml wässriger Lösung in einer 1 cm Quartz-Küvette. Ein Verhältnis von ungefähr OD260=1,8 wird im Allgemeinen als "reine" DNA bezeichnet. RNA besitzt hingegen einen höheren Wert von OD260=2,0.
Verunreinigungen mit Proteinen, Phenol oder anderen Substanzen führen zu einer Erhöhung dieses Wertes. 

Im Falle von Oligonucleotiden verhält sich dies jedoch anders. Die synthetisch hergestellten Oligos kommen im Gegensatz zu aus Zellen extrahierter DNA nicht in Kontakt mit Proteinen, sodass die Messung bei 280 nm nicht relevant ist.
Ein weiterer, nicht zu vernachlässigender Punkt der Oligonucleotide von DNA- oder RNA-Molekülen unterscheidet, besteht in der Ungleichverteilung der vier Basen (A, C, G, T oder U). Jedes Nucleotid besitzt ein eigenes Absorptionsmaximum (siehe Abbildungen unten). Liegt keine Gleichverteilung der Basen vor, so verschiebt sich dieser Wert und abweichende Ergebnisse sind die Folge. Aufgrund der geringen Länge der Oligonucleotide kann sich über deren Länge kein "bias" für eine Basensorte herausnivellieren und die Extinktionswerte der Basen müssen in die Berechnung mit einbezogen werden.
Bei der Analyse von Oligonucleotiden mit einem Spektralphotometer, sollte diese Besonderheit stets beachtet werden.

                            
 

Für jede Oligonucleotidsequenz ist der Extinktionskoeffizient Epsilon ɛ260 verschieden und kann durch das sogenannte Nearest-Neighbor-Verfahren auch relativ genau bestimmt werden. Er entspricht in guter Näherung der Summe der Extinktionskoeffizienten der in der Sequenz vorhandenen einzelnen Nucleotide. 
Mithilfe der Sequenzdaten und des OD-Wertes kann die Stoffmenge n berechnet werden.

Base Monomer-Extinktionskoeffizient gemessen bei 260 nm [mM-1 cm-1]
Adenin  1,54
Cytosin 0,75
Guanin   1,17
Thymin 0,92



n [nmol]=  (100 ∙ E260 nm)/(1,54 ∙ A + 1,17 ∙ G + 0,75 ∙ C + 0,92 ∙ T)

Für Oligonucleotidsequenzen, die einer Gleichverteilung der vier Basen unterliegen, ergeben sich in Abhängigkeit zur Oligolänge folgende Werte für die Stoffmenge [nmol]:

OD-Wert                                                     Oligolänge [Anz. Oligonucleotide]
  10 20 30 40 50 60 70 80 90 100
1 9,4  4,7  3,1  2,3 1,9 1,6  1,3 1,2 1,0  0,9
3 28  14 9 7 5,6  4,7 4,0 3,5 3,1  2,8
10 94  47 31 23  19 16 13 12 10  9
25  234  117 78 59  47 39  33 29 26 23
100 937 468 312  234 187 156 134 117 104 94
 

Beispielrechnung: 

Sequenz: AGGTCCTTAGGCTGACGTTAAGCCTA
nA=6    nC=6    nG=7    nT=7
OD=10 (experimentell gemessen)

n [nmol]=  (100 ∙10)/(1,54 ∙6+1,17 ∙7+0,75 ∙6+0,92 ∙7)=35,25

Aus der Stoffmengenangabe [nmol] und dem Molekulargewicht [g/mol] des Oligonucleotids lässt sich die Oligonucleotidmenge in µg errechnen: 

n [µg]=(n [nmol]∙MWOligo  [g/mol])/1000

MWOligo=313,2∙A+329,2∙G+289,2∙C+304,2∙T+MWmod-62 [g/mol]  


A,C,G,T: Anzahl der vorhandenen Basen im Oligo
MWmod: Molekulargewicht einer Modifikation, wenn vorhanden 

Wie stabil sind meine Oligonucleotide und wie sollte ich sie lagern?

Bereits die Wahl des richtigen Lösungsmittels kann die Lebensdauer eines Oligonucleotids positiv beeinflussen. Die Stabilität von Oligonucleotiden kann mithilfe einer optimalen Lagerung ebenfalls enorm verbessert werden. Wenn Sie zudem noch ein paar simple Regeln befolgen, können Sie Ihre Oligos lange problemlos und ohne Bedenken verwenden. Hier erfahren Sie mehr.

Lieferung

 

Lieferung und Lieferkosten

Jede Bestellung wird schnellstmöglich bearbeitet, sodass bei Ihnen keine langen Wartezeiten entstehen. Automatisch werden Sie über den Versand Ihrer Oligos von uns informiert. Die Versandart können Sie bei Ihrer Bestellung festlegen. Standardmäßig wird innerhalb von Deutschland mit dem DHL Standardversand verschickt. Aber auch andere, schnellere Liefermöglichkeiten können gegen Aufpreis im Bestellformular ausgewählt werden. Falls Sie eine DHL-Express-Lieferung wünschen, geben Sie dies bitte in der Bestellung durch Auswahl im entsprechenden Pulldown-Menü an. 

                         

Lieferungen innerhalb der Stadt Ulm werden von einem Fahrradkurier versandkostenfrei zugestellt. 
Lieferungen, die nicht innerhalb von Deutschland erfolgen, werden von Fedex übernommen.
Lieferkosten 

Wie lange dauert die Lieferung meiner Oligos in Deutschland und in der EU?

Innerhalb von Deutschland erhalten Sie mit der DHL innerhalb von 1-2 Werktagen Ihre Ware. Bei einem Warenwert von über 125,00 € erhalten Sie Ihre Bestellung versandkostenfrei. 
Bestellungen innerhalb von Ulm werden immer versandkostenfrei mit dem Fahrradkurier ausgeliefert und können auf diese Weise nach Fertigstellung Ihres Oligos vormittags des folgenden Werktages an Sie zugestellt werden. 
Lieferungen in EU-Mitgliedstaaten erfolgen mit dem Lieferunternehmen Fedex und dauern durchschnittlich 1-2 Werktage. Weisen Bestellungen einen Warenwert von 750 € bzw. 650 £ auf, werden diese versandkostenfrei verschickt. 
Wenn Sie oder Ihr Institut über eine VAT-Nummer verfügen, geben Sie diese bitte bei Ihrer Bestellung mit an. 

Lieferung ins außereuropäische Ausland

Lieferungen, die außerhalb der EU erfolgen, werden mit dem Lieferunternehmen Fedex durchgeführt. Größere Zentren beliefert Fedex weltweit meist innerhalb von 2 Werktagen, ansonsten liegen die durchschnittlichen Lieferzeiten bei 2-5 Werktagen. 
Bei Lieferungen außerhalb der EU werden zu den üblichen Lieferkosten noch zusätzliche Gebühren, wie Steuern, Zölle und Bearbeitungsgebühren fällig. 
Alle unsere Bestellungen werden so schnell wie möglich von uns bearbeitet und an Sie versandt. Bei Sendungen ins Ausland kann es jedoch zu Verzögerungen durch den Zoll kommen, die wir nicht beeinflussen können.

Lieferzustand meiner Oligonucleotide bei Auslieferung

Oligonucleotide können bei uns in zwei unterschiedlichen Zuständen geliefert werden:

- in lyophilisierten (getrockneten) Zustand oder
- gelöst in einem Lösungsmittel mit spezifisch eingestellter Konzentration

Wir empfehlen die Lieferung im getrockneten Zustand, da auf diese Weise Oligonucleotide die höchste Stabilität aufweisen. In trockenen Zustand sind Oligos sehr stabil und können auch bei RT oder 4°C kurzzeitig aufbewahrt werden. Längerfristig empfiehlt es sich jedoch Oligonucleotide bei 
-20°C zu lagern. Dies gilt vor allem, wenn längere Lagerzeiten von über 3 Monaten beabsichtigt sind. 
Im gelösten Zustand sind Oligonucleotide besonders durch den Abbau durch Nucleasen gefährdet, weshalb auch hier eine Lagerung bei -20°C zu empfehlen ist, da hierdurch die Aktivität der Nucleasen minimiert wird. Ebenfalls beeinflusst häufiges Auftauen und wieder Einfrieren die Qualität und Stabilität der Lösungen und sollten deshalb weitestgehend vermieden werden. Auch eine Aliquotierung der Stocklösung ist hier empfehlenswert. 
Zum Thema Lösen und Lagern der gelieferten Oligos erhalten Sie auch auf unserer Website ausführliche Informationen. 
Hier erfahren Sie mehr.

Auslieferungsbenachrichtigung

Nach der Synthese und der Qualitätskontrolle jedes Oligos werden Sie automatisch benachrichtigt, wenn Ihre Versanddaten elektronisch an das Versandunternehmen übermittelt werden. Auf diese Weise sind Sie immer auf dem Laufenden und können Ihre weiteren Versuche optimal planen. 

Versand digitaler Auftragsdokumente per E-Mail

Der Versand auftragsrelevanter Dokumente ist nun auch per E-Mail möglich.
Lassen Sie sich Rechnungen und/oder Qualitätszertifikate im PDF-Format ab sofort bequem per E-Mail an einefür Ihre Rechnungen bestimmte E-Mail Adresse zusenden. Dies können Sie entweder in Ihrem Benutzerprofil anmerken oder auch direkt während der Online-Bestellung unter „Liefermodus auftragsbezogene Dokumente“.
Bitte beachten Sie, der digitale Versand ersetzt den Papierversand, die Papierversion wird dann nicht mehr verschickt.                                                          

                                 


Sicherheit von via Email versandten Daten:

Bitte denken Sie daran, dass Email prinzipiell kein sicheres Übertragungsmedium darstellt.

biomers.net verwendet auf seinen Mailservern die sog. Opportunistic Encryption. Bei diesem Verfahren werden übertragene Daten zwar verschlüsselt, wenn der Mailserver Ihrer Einrichtung oder Firma dieses ebenfalls anbietet, jedoch wird dabei nicht überprüft, ob der Empfänger der Email tatsächlich der ist, der er vorgibt zu sein, und falls der empfangene Mailserver keine Verschlüsselung unterstützt, werden die Daten im Klartext übertragen.

Für normale Sicherheitsbedürfnisse ist das i.d.R. vollkommen ausreichend.

Falls Sie jedoch hohe Sicherheitsanforderungen in Hinsicht auf Ihre Oligosequenzen haben, empfehlen wir Ihnen entweder weiterhin das gedruckte Papierzertifikat zu verwenden oder das digitale Zeritifikat aus Ihrem Webarchiv herunterladen. Da bei letzterem die Übertragung nicht nur verschlüsselt ist, sondern das verwendete digitale Zertifikat auch sicherstellt, dass die Daten tatsächlich direkt von biomers.net heruntergeladen werden, ist es sehr schwer, hierbei Daten abzugreifen.  

Bezahlung

 

Zahlungsmöglichkeiten 

Innerhalb von Deutschland können Sie vorzugsweise Ihre Bestellung per Banküberweisung bezahlen. 
Weitere von uns akzeptierte Zahlungsmethoden sind Vorkasse oder Kreditkarte. 

Bitte beachten:
Bei Bestellungen aus Nicht-EU-Mitgliedsstaaten behalten wir uns vor, ob eine Zahlung per Überweisung oder Vorkasse bzw. Kreditkarte erfolgt. Unser Kundenservice wird sich in diesem Fall mit Ihnen in Verbindung setzen und eine für Sie passende Zahlungsmethode finden. Sobald wir einen Geldeingang von Ihnen verbuchen können, wird die Synthese Ihrer Oligos umgehend gestartet. Die Zahlungen können Sie per Kreditkarte oder Überweisung auf unser Konto durchführen. Teilen Sie uns bei der Bestellung einfach mit, welche Zahlungsmethode Sie bevorzugen. 

Anlegen eines Guthabenkontos

Gerne richten wir für Sie ein Guthabenkonto ein, von dem dann Ihre Lieferungen komfortabel abgebucht werden können. Das Guthabenkonto führen wir ohne zeitliche Begrenzung. 

Die praktische Vorgehensweise wäre folgendermaßen: 
Sie überweisen uns den von Ihnen gewünschten Betrag, wobei sich dieser immer inklusive gesetzlicher Mehrwertsteuer versteht. Nach Eingang der Zahlung kann dann über das Guthaben verfügt werden. Mit jeder Lieferung erhalten Sie eine Rechnung; diese trägt dann den Vermerk "Abrufauftrag, Rechnung bereits beglichen". 
Damit wir erkennen können, welche Bestellungen mit dem Guthaben verrechnet werden sollen, sollten Sie dies bei der Bestellung (bei Online-Bestellungen im Kommentarfeld "Anmerkung") unbedingt mit angeben ("mit Guthaben verrechnen"). Bestellungen ohne einen solchen Hinweis werden separat berechnet und wären dann auch separat zu bezahlen. Auf diese Weise können Sie gezielt über das Guthaben verfügen.

Kontakt

 

An wen kann ich mich bei Fragen wenden? 

Wenn Sie Fragen haben oder Hilfe benötigen bei der Auswahl Ihrer Oligonucleotide können Sie uns jederzeit gerne kontaktieren.
Telefonisch unter +49 731 70 396 0 oder per E-Mail unter info@biomers.net sind wir werktags von 7.00-19.00 Uhr für Sie erreichbar. 
Gerne können Sie sich mit uns auch über unser Kontaktformular in Verbindung setzen. 
Wir beraten Sie gerne und helfen Ihnen bei der Realisierung Ihrer Forschung.