Page id: 243

Mediator-Sonden PCR (Mediator Probe PCR, MP PCR)
 

Mediator-Sonden PCR (MP PCR)

Mediator-Sonden PCR


Im Bereich der Real-Time-PCR wurden in den letzten Jahren eine Vielzahl unterschiedlicher Anwendungen entwickelt. Neben dem klassischen 5´-Nuclease Assay (TaqMan) wurden Molecular Beacons, Scorpions, HybProbes, Hybeacons und viele weitere Formate erfolgreich etabliert. Allen gemeinsam ist dabei die Messung der Fluoreszenzzunahme im Laufe der fortschreitenden PCR-Reaktion, sowie die Notwendigkeit einer individuellen fluoreszenzmarkierten Sonde (einzeln oder in Kombination mit einem Primer) pro Nachweis.

Die neue Mediatorsonden-PCR bzw. Mediator Probe PCR (MP PCR) ist eine hoch sensitive und spezifische und gleichzeitig sehr flexible Variante. Hier kann eine einzige farbstoffmodifizierte Komponente (Universal Reporter) für viele unterschiedliche Assays eingesetzt werden, wobei nur die Primer und eine unmarkierte Sonde (Mediatorsonde) für den jeweiligen Nachweis individuell designt werden müssen.
 

Oligonucleotid-Bestandteile einer Mediator Probe PCR:

Primer: Wie bei jeder PCR findet die Amplifikation der Zielsequenz mithilfe zweier Primer statt. Es wird ein Forward und ein Reverse Primer nach den üblichen Designregeln erstellt.

Mediator Probe (MP) bzw. Mediatorsonde: Die Mediatorsonde ist ein unmarkiertes Oligonucleotid mit einer Länge von ca. 40-50 Nucleotiden und einer Blockgruppe (MP-Block) am 3´-Ende, die eine Verlängerung während der PCR verhindert. Die eine Hälfte der Sequenz (3´-Ende) ist spezifisch für das amplifizierte Target, die andere Hälfte der Sequenz (5´-Ende) wird als Mediator bezeichnet und passt zum verwendeten Universal Reporter (Abbildung 1). 

Abbildung 1: Mediatorsonde (Mediator Probe, MP) 

Universal Reporter (UR): Beim Universal Reporter handelt es sich um eine Art Molecular Beacon mit einer verlängerten 3‘-Region, an die der passend komplementäre Mediator andocken kann. In der Stem-Struktur des Universal Reporters liegt einem Fluoreszenzfarbstoff (innerhalb der Sequenz) ein Quenchermolekül (5´-Ende) gegenüber, sodass der Universal Reporter im geschlossenem Zustand keine Fluoreszenz zeigt. Weiterhin trägt der Universal Reporter am 3´-Ende ebenfalls eine Blockgruppe, was die Elongation verhindert (Abbildung 2).


                      

Abbildung 2: Universal Reporter (UR)


Ablauf einer Mediator Probe PCR:

Wie üblich wird die gewünschte Zielsequenz mit Hilfe der gewählten Primer amplifiziert. Der Verlauf der PCR wird über eine Zunahme der Fluoreszenz beobachtet.
Hierzu hybridisiert die Mediatorsonde zunächst mit ihrem spezifischen Teil an die Zielsequenz. Beim nachfolgenden Amplifikationsschritt spaltet die Polymerase durch ihre 5´-3´-Exonucleaseaktivität den Mediatorteil als Ganzes von der Mediatorsonde ab und verdaut den spezifischen Teil mit schrittweisem Aufbau des Gegenstrangs. 

Der so freigesetzte Mediator kann nun den Universal Reporter aktivieren, indem er an die einzelsträngige 3´-Region des UR bindet und durch die Polymeraseaktivität verlängert wird. Hierdurch werden Fluorophor und Quencher voneinander getrennt und die zunehmende freigesetzte Fluoreszenz kann detektiert werden. 

Ein enormer Vorteil gegenüber klassischer Real-Time PCR Anwendungen ist der Verzicht einer Target-spezifischen fluoreszenzmarkierten Sonde. Bei der Mediator Probe PCR kann der Universal Reporter in unterschiedlichen Assays verwendet werden. Lediglich die Primer und die unmarkierte Mediator Probe (MP) müssen jeweils neu designt werden. 

Durch den Einsatz mehrerer abgestimmter Universal Reporter mit passend gewählten Fluoreszenzfarbstoffen ist zudem ein Multiplexing möglich. Die Mediatorsonden werden dabei so designt, dass sie an den entsprechenden Universal Reporter hybridisieren können.

Die folgenden Universal Reporter mit den entsprechenden Fluoreszenzfarbstoffen stehen standardmäßig zur Verfügung (unterstrichen ist jeweils die Mediatorbinderegion):

Universal Reporter URA (Fam)
ATTGCGGGAGATGAGACCCGCAATTGTTGGTCGTAGAGCCCAGAACGA

Universal Reporter URB (Hex)
GACCGGCTAAGACGCGCCGGTCTGTTGCACCTGGGACATCGACTAT

Universal Reporter URC (Rox)
GACCGCACTAGTAGATGCGGTCTGTCGTGGACCCTGTATCGAGCA

Universal Reporter URD (Cyanine 5)
GACCGGCCAAGACGCGCCGGTCTGTTCACTGACCGAACTGGAGCA

Universal Reporter URE (Cyanine 5.5)
GACGCGTAGTACAGAACGCGTCTGTTCAGTGAGCCTACCTGCCTTC

Individuelle Mediatorsonden können in unterschiedlichen Scales direkt bequem online bestellt werden. 

Achtung: die Mediatorsonde selbst darf im eigentlichen Amplifikationsschritt nicht als Primer fungieren und dabei verlängert werden können. Aus diesem Grund wählen Sie bitte unbedingt „MP-Block“ als 3´-Modifikation.

In Kürze erreichen Sie an dieser Stelle auch einen Zugang zu einer ersten Testversion einer Designsoftware für Mediator Probes (MP-PCR Desire). Diese Software wurde im Rahmen eines geförderten ZIM-Projektes erstellt (Projektpartner: Albert-Ludwigs-Universität Freiburg, Philipps-Universität Marburg, Cap3 GmbH, biomers.net GmbH).
 



Literatur: 

- Mediator Probe PCR: Detection of Real-Time PCR by Label-Free Probes and a Universal Fluorogenic Reporter. Wadle S, Rubenwolf S, Lehnert M, Faltin B, Weidmann M, Hufert F, Zengerle R, von Stetten F. Methods Mol Biol. (2014), 1160:55-73. doi: 10.1007/978-1-4939-0733-5_6.

- Mediator Probe PCR: A Novel Approach for Detection of Real-Time PCR Based on Label-Free Primary Probes and Standardized Secondary Universal Fluorogenic Reporters. Faltin B, Wadle S, Roth G, Zengerle R, von Stetten F; Clinical Chemistry (2012), 58:11; 1546–1556.

- Real-time PCR probe optimization using design of experiments approach. Wadle S, Lehnert M, Rubenwolf S, Zengerle R, von Stetten F. Biomolecular Detection and Quantification 7 (2016), 1–8.

- Simplified development of multiplex real-time PCR through master mix augmented by universal fluorogenic reporters. Wadle S, Lehnert M, Schuler F, Köppel R, Serr A, Zengerle R, von Stetten F. BioTechniques (2016) 61:123-128 doi 10.2144/000114443